Top » Catalog » SNPs » Y91969

$18.00

Y91969
[Y91969]

Y91969
hg38 Position: ChrY:12582140..12582140
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y91969_F TGAGATAGAGTCTCACTTTGTTGCC
Reverse Primer: Y91969_R TTTTGTAGTAGTCTAATGATTTGAGACCTTAG
Reviews

Customers who bought this product also purchased
BY162752
BY162752
Z2293
Z2293
ZS1431
ZS1431
Z640
Z640
ZS1482
ZS1482
J1-M267 Superclade Panel
J1-M267 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies