Top » Catalog » SNPs » Y181021

$18.00

Y181021
[Y181021]

Y181021
hg38 Position: ChrY:8918326..8918326
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below DF27 > BY41650
Forward Primer: Y181021_F AGAAGGGGCGGCTGGAG
Reverse Primer: Y181021_R GGATTGCAGAGGGAGTCTCC
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies