Top » Catalog » SNPs » FGC11984

$18.00

FGC11984
[FGC11984]

FGC11984
hg38 Position: ChrY:11710780..11710780
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c (not listed)
Comments: Approx. R-L21 below S9294
Forward Primer: FGC11984v2_F CTCGAATAGAATGGAAACAAACG
Reverse Primer: FGC11984v2_R TCACATCCTATTCTATTCCATGTCC
Reviews

Customers who bought this product also purchased
R1b-Z251 11EE downstream
R1b-Z251 11EE downstream
FGC12000
FGC12000
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies