Top » Catalog » SNPs » Y196998

$18.00

Y196998
[Y196998]

Y196998
hg38 Position: ChrY:13955218..13955218
Ancestral: G
Derived: A
Reference: YFull (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y196998_F CACCCTAACATCACAATTAAAAGAATC
Reverse Primer: Y196998_R CATTTATTGATTTGCATGTACTGAATG
Reviews

Customers who bought this product also purchased
I2-Y56203-Herzegovina
I2-Y56203-Herzegovina
Y196690
Y196690
Y196971
Y196971
Y197097
Y197097
Y196220
Y196220
FT25907
FT25907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies