Top » Catalog » SNPs » Y196998

$18.00

Y196998
[Y196998]

Y196998
hg38 Position: ChrY:13955218..13955218
Ancestral: G
Derived: A
Reference: YFull (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y196998_F CACCCTAACATCACAATTAAAAGAATC
Reverse Primer: Y196998_R CATTTATTGATTTGCATGTACTGAATG
Reviews

Customers who bought this product also purchased
Y196690
Y196690
Y196971
Y196971
Y197097
Y197097
Y196220
Y196220
FT25907
FT25907
Y196599
Y196599
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies