Top » Catalog » SNPs » Y196971

$18.00

Y196971
[Y196971]

Y196971
hg38 Position: ChrY:15202016..15202016
Ancestral: A
Derived: T
Reference: YFull (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y196971_F CCTTAAGATAATGCCCTCCAGG
Reverse Primer: Y196971_R AAGGGCCAGTTATGTTCAAATG
Reviews

Customers who bought this product also purchased
I2-Y56203-Herzegovina
I2-Y56203-Herzegovina
Y196690
Y196690
Y196998
Y196998
Y197097
Y197097
Y196220
Y196220
FT25907
FT25907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies