Top » Catalog » SNPs » Y196220

$18.00

Y196220
[Y196220]

Y196220
hg38 Position: ChrY:14888134..14888134
Ancestral: C
Derived: A
Reference: YFull (2020)
ISOGG Haplogroup: I2a
Comments: Below PH908 > FT14506 > Y56203
Forward Primer: Y196220_F TGATGATGGGGACATACAGG
Reverse Primer: Y196220_R CCTCACCCGAGAATCCCC
Reviews

Customers who bought this product also purchased
Y196971
Y196971
Y197097
Y197097
FT25907
FT25907
Y196599
Y196599
I2-Y56203-Herzegovina
I2-Y56203-Herzegovina
Y196690
Y196690
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies