Top » Catalog » SNPs » FGC12000

$18.00

FGC12000
[FGC12000]

FGC12000
hg38 Position: ChrY:16289859..16289859
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c (not listed)
Comments: Approx. R-L21 below S9294
Forward Primer: FGC12000_F TTGGGAAGCCAAAGCAGTAG
Reverse Primer: FGC12000_R TCCTTGGGAGGTACTTTCCTG
Reviews

Customers who bought this product also purchased
FGC11984
FGC11984
R1b-Z251 11EE downstream
R1b-Z251 11EE downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies