Top » Catalog » SNPs » S1050

$19.00

S1050
[S1050]

S1050
hg38 Position: ChrY:14192128..14192128
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in members of the 9919 cluster
Forward Primer: S1050_F TTAAGTTCTCACTGTTTGCTAGCAG
Reverse Primer: S1050_R GGAAAGCAGAGCTGGGGAC
Reviews

Customers who bought this product also purchased
M9
M9
FGC52058
FGC52058
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
FGC20611
FGC20611
FGC43088
FGC43088
L21
L21
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies