Top » Catalog » SNPs » S1050

$18.00

S1050
[S1050]

S1050
hg38 Position: ChrY:14192128..14192128
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in members of the 9919 cluster
Forward Primer: S1050_F TTAAGTTCTCACTGTTTGCTAGCAG
Reverse Primer: S1050_R GGAAAGCAGAGCTGGGGAC
Reviews

Customers who bought this product also purchased
R1b-S1051 Panel
R1b-S1051 Panel
A4604
A4604
FGC9682
FGC9682
S16264
S16264
Z16500
Z16500
FGC29517
FGC29517
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16435
1 x B397
$36.00
Haplogroup Info
Other products
Currencies