Top » Catalog » SNPs » S1050

$18.00

S1050
[S1050]

S1050
hg38 Position: ChrY:14192128..14192128
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in members of the 9919 cluster
Forward Primer: S1050_F TTAAGTTCTCACTGTTTGCTAGCAG
Reverse Primer: S1050_R GGAAAGCAGAGCTGGGGAC
Reviews

Customers who bought this product also purchased
FGC19454
FGC19454
FGC17907
FGC17907
Z39589
Z39589
FGC17897
FGC17897
FGC17898
FGC17898
FGC17866
FGC17866
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies