Top » Catalog » SNPs » Z5016

$18.00

Z5016
[Z5016]

Z5016
hg38 Position: ChrY:7932900..7932900
Ancestral: G
Derived: A
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from CTS9320 parallel to Z5018
Forward Primer: Z5016_F GCATCACACAGGTGTTGTGCT
Reverse Primer: Z5016_R GACAGGTGACTTTGCCCAGT
Reviews

Customers who bought this product also purchased
FGC71977
FGC71977
Y16729
Y16729
BY4684
BY4684
BY4642
BY4642
BY4574
BY4574
BY4523
BY4523
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies