Top » Catalog » SNPs » Z5016

$18.00

Z5016
[Z5016]

Z5016
hg38 Position: ChrY:7932900..7932900
Ancestral: G
Derived: A
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from CTS9320 parallel to Z5018
Forward Primer: Z5016_F GCATCACACAGGTGTTGTGCT
Reverse Primer: Z5016_R GACAGGTGACTTTGCCCAGT
Reviews

Customers who bought this product also purchased
Y161799
Y161799
Y97307
Y97307
BY4600
BY4600
SK888
SK888
BY4455
BY4455
Y161798
Y161798
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies