Top » Catalog » SNPs » Z5017

$18.00

Z5017
[Z5017]

Z5017
hg38 Position: ChrY:26365592..26365592
Ancestral: G
Derived: A
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from CTS9320 parallel to Z5018
Forward Primer: Z5017_F AGTATACAGTTACAATTTTCTGTCCAATGA
Reverse Primer: Z5017_R CTACTGTGTTACACCGAGCCTG
Reviews

Customers who bought this product also purchased
BY50887
BY50887
BY155589
BY155589
Y161799
Y161799
Y97307
Y97307
BY4600
BY4600
SK888
SK888
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies