Top » Catalog » SNPs » Z5017

$18.00

Z5017
[Z5017]

Z5017
hg38 Position: ChrY:26365592..26365592
Ancestral: G
Derived: A
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from CTS9320 parallel to Z5018
Forward Primer: Z5017_F AGTATACAGTTACAATTTTCTGTCCAATGA
Reverse Primer: Z5017_R CTACTGTGTTACACCGAGCCTG
Reviews

Customers who bought this product also purchased
Y173822
Y173822
FGC11444
FGC11444
Y17747
Y17747
BY124165
BY124165
FGC71980
FGC71980
Y83041
Y83041
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies