Top » Catalog » SNPs » Z5017

$18.00

Z5017
[Z5017]

Z5017
hg38 Position: ChrY:26365592..26365592
Ancestral: G
Derived: A
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from CTS9320 parallel to Z5018
Forward Primer: Z5017_F AGTATACAGTTACAATTTTCTGTCCAATGA
Reverse Primer: Z5017_R CTACTGTGTTACACCGAGCCTG
Reviews

Customers who bought this product also purchased
BY4684
BY4684
BY4642
BY4642
FGC71977
FGC71977
Y178742
Y178742
BY5500
BY5500
BY4574
BY4574
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies