Top » Catalog » SNPs » BY131257

$18.00

BY131257
[BY131257]

BY131257
hg38 Position: ChrY:19066043..19066043
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: Below Z38463
Forward Primer: BY131257_F TTGGTAAATCTGTGAGCAGTGG
Reverse Primer: BY131257_R ACCTGAGTAGCTCGGACCAC
Reviews

Customers who bought this product also purchased
SK1356
SK1356
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies