Top » Catalog » SNPs » L143

$18.00

L143
[L143]

L143
hg38 Position: ChrY:15314237..15314237
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1a1b1a2
Comments: Aka DYS643 Null. downstream of E-V13 > A2192
Forward Primer: L143_F ATCCGTGAACCAGAAAGTGG
Reverse Primer: L143_R TTGGGAACTCAAGGGAAGG
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
ZS10715
ZS10715
Y23481
Y23481
ZQ303
ZQ303
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies