Top » Catalog » SNPs » BY102020

$18.00

BY102020
[BY102020]

BY102020
hg38 Position: ChrY:13389629..13389629
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY102020_F CAAACTCCCAGGATGCTTTTAAC
Reverse Primer: BY102020_R GGAAAGATCTGTAGCCTGAAATATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies