Top » Catalog » SNPs » FT167709

$18.00

FT167709
[FT167709]

FT167709
hg38 Position: ChrY:8459009..8459009
Ancestral: T
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT16449 > Y126296 > Y81557
Forward Primer: FT167709_F CATGGGTGCGTTGTGAGG
Reverse Primer: FT167709_R TGTTTGTTGGTGCCTGTCAG
Reviews

Customers who bought this product also purchased
FT165340
FT165340
FT167865
FT167865
FT170299
FT170299
FT167636
FT167636
FT170034
FT170034
FT167267
FT167267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies