Top » Catalog » SNPs » FT167709

$18.00

FT167709
[FT167709]

FT167709
hg38 Position: ChrY:8459009..8459009
Ancestral: T
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT16449 > Y126296 > Y81557
Forward Primer: FT167709_F CATGGGTGCGTTGTGAGG
Reverse Primer: FT167709_R TGTTTGTTGGTGCCTGTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies