Top » Catalog » SNPs » FT168912

$18.00

FT168912
[FT168912]

FT168912
hg38 Position: ChrY:13270353..13270353
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT16449 > Y126296 > Y81557
Forward Primer: FT168912_F GCCTTAGCATTTGCATTGTCAC
Reverse Primer: FT168912_R GGGGTGTGGCATAGAGTAATTCT
Reviews

Customers who bought this product also purchased
FT170299
FT170299
FT167636
FT167636
FT170034
FT170034
FT167267
FT167267
I2-PH908_Y81557 Sremac Panel
I2-PH908_Y81557 Sremac Panel
FT167234
FT167234
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies