Top » Catalog » SNPs » FT170034

$18.00

FT170034
[FT170034]

FT170034
hg38 Position: ChrY:16134863..16134863
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT16449 > Y126296 > Y81557
Forward Primer: FT170034_F ATCCTTAAGCTTCCAGAGCAAATAC
Reverse Primer: FT170034_R TCATGAGACTTATTCATTATTTGAGAATGT
Reviews

Customers who bought this product also purchased
FT165387
FT165387
FT167865
FT167865
FT165340
FT165340
FT167709
FT167709
FT170299
FT170299
FT167636
FT167636
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies