Top » Catalog » SNPs » FT170299

$18.00

FT170299
[FT170299]

FT170299
hg38 Position: ChrY:17007334..17007334
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT16449 > Y126296 > Y81557
Forward Primer: FT170299no_F GAGCACAATGGACACCACAC
Reverse Primer: FT170299no_R TCATAGGTTCGTCACACCCTC
Reviews

Customers who bought this product also purchased
FT167234
FT167234
FT165387
FT165387
FT167865
FT167865
FT165340
FT165340
FT167709
FT167709
FT170034
FT170034
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies