Top » Catalog » SNPs » FT170299

$18.00

FT170299
[FT170299]

FT170299
hg38 Position: ChrY:17007334..17007334
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT16449 > Y126296 > Y81557
Forward Primer: FT170299_F GAGCACAATGGACACCACAC
Reverse Primer: FT170299_R GGTGGTTTGGAGTGATTCAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x mtUpgrade
$115.00
Haplogroup Info
Other products
Currencies