Top » Catalog » SNPs » FGC4133

$18.00

FGC4133
[FGC4133]

FGC4133
hg38 Position: ChrY:22301607..22301607
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a5
Comments: Downstream R1b-M222/S660
Forward Primer: FGC4133_F ACATGAATTTTGACCTATGTTTAAAATAAC
Reverse Primer: FGC4133_R AATTCCAGGTTTCATATGATAAGGC
Reviews

Customers who bought this product also purchased
Y150210
Y150210
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
L21
L21
BY108617
BY108617
L51
L51
FGC32795
FGC32795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies