Top » Catalog » SNPs » FGC4133

$18.00

FGC4133
[FGC4133]

FGC4133
hg38 Position: ChrY:22301607..22301607
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a5
Comments: Downstream R1b-M222/S660
Forward Primer: FGC4133_F ACATGAATTTTGACCTATGTTTAAAATAAC
Reverse Primer: FGC4133_R AATTCCAGGTTTCATATGATAAGGC
Reviews

Customers who bought this product also purchased
FT252196
FT252196
BY35726
BY35726
YP4685
YP4685
BY35727
BY35727
FT410057
FT410057
BY35731
BY35731
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies