Top » Catalog » SNPs » Y32348

$18.00

Y32348
[Y32348]

Y32348
hg38 Position: ChrY:21580041..21580041
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: Aka YFS387800
Forward Primer: Y32348_F AAGCGTCTTTCACTGGGCT
Reverse Primer: Y32348_R AGAGAGACTCCATCACAAAAAAATAATAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies