Top » Catalog » SNPs » FT288608

$18.00

FT288608
[FT288608]

FT288608
hg38 Position: ChrY:16492424..16492424
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: R1a
Comments: Below M458 > L1029 > YP728 > YP6047
Forward Primer: FT288608_F GCAAGGAGATGGAGTTCACC
Reverse Primer: FT288608_R TTTGCTTCTAAGAGGAGTTGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies