Top » Catalog » SNPs » FT288689

$18.00

FT288689
[FT288689]

FT288689
hg38 Position: ChrY:17162637..17162637
Ancestral: T
Derived: A
Reference: FTDNA (2020)
ISOGG Haplogroup: R1a
Comments: Below M458 > L1029 > YP728 > YP6047
Forward Primer: FT288689_F GCCTTGCCTGATTTTCAATATGT
Reverse Primer: FT288689_R TGTGTACATAAAATCTTTTTGTGTCCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies