Top » Catalog » SNPs » Z16521

$18.00

Z16521
[Z16521]

Z16521
hg38 Position: ChrY:19066799..19066799
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1a
Comments: downstream of CTS4466
Forward Primer: Z16521_F CGATAGCAAATCCAGTGCAG
Reverse Primer: Z16521_R TGTTAGGGAGCCTTCCATTG
Reviews

Customers who bought this product also purchased
S1115
S1115
BY2880
BY2880
FGC29290
FGC29290
A1511
A1511
A2221
A2221
FGC29280
FGC29280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies