Top » Catalog » SNPs » Z16521

$18.00

Z16521
[Z16521]

Z16521
hg38 Position: ChrY:19066799..19066799
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1a
Comments: downstream of CTS4466
Forward Primer: Z16521_F CGATAGCAAATCCAGTGCAG
Reverse Primer: Z16521_R TGTTAGGGAGCCTTCCATTG
Reviews

Customers who bought this product also purchased
FT43021
FT43021
BY39364
BY39364
A9005
A9005
BY39361
BY39361
A541
A541
BY39363
BY39363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies