Top » Catalog » SNPs » A224

$18.00

A224
[A224]

A224
hg38 Position: ChrY:13715118..13715118
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1a1a4a
Comments: R1b-M222/S660
Forward Primer: A224_F TCCATATCTTCAGCCACCAAC
Reverse Primer: A224_R CAGGGAGCTAAGTGTGATTGC
Reviews

Customers who bought this product also purchased
A984
A984
A10528
A10528
ZS8379
ZS8379
FGC23742
FGC23742
DF13
DF13
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies