Top » Catalog » SNPs » A224

$18.00

A224
[A224]

A224
hg38 Position: ChrY:13715118..13715118
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1a1a4a
Comments: R1b-M222/S660
Forward Primer: A224_F TCCATATCTTCAGCCACCAAC
Reverse Primer: A224_R CAGGGAGCTAAGTGTGATTGC
Reviews

Customers who bought this product also purchased
FGC23742
FGC23742
DF13
DF13
Z39589
Z39589
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
BY18130
BY18130
BY11697
BY11697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
$18.00
Haplogroup Info
Other products
Currencies