Top » Catalog » SNPs » FT81937

$18.00

FT81937
[FT81937]

FT81937
hg38 Position: ChrY:12900736..12900736
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FT81937_F CAGTAGCTGGGATTACAGGTGC
Reverse Primer: FT81937_R CCTGTAATTAATGCCACTAAACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies