Top » Catalog » SNPs » BY118888

$18.00

BY118888
[BY118888]

BY118888
hg38 Position: ChrY:15865061..15865061
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L48 > Z2 > Z11
Forward Primer: BY118888_F CTTCAAGGGAAATTCCAGGTAG
Reverse Primer: BY118888_R CAAGCAAGGAAAATTGGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies