Top » Catalog » SNPs » FGC53764

$18.00

FGC53764
[FGC53764]

FGC53764
hg38 Position: ChrY:13595252..13595252
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b
Comments: Below L48 > Z2 > Z11
Forward Primer: FGC53764_F TCAAAACAAGGGAAGCCAAG
Reverse Primer: FGC53764_R TTTAATATTACCATGCCCTGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies