Top » Catalog » SNPs » FT144272

$18.00

FT144272
[FT144272]

FT144272
hg38 Position: ChrY:19394907..19394907
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: Below L48 > Z2 > Z11
Forward Primer: FT144272_F TGAAGCTCAGTTTCACTGGATATG
Reverse Primer: FT144272_R CTCCATGATATTTGGGATTATGTTAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies