Top » Catalog » SNPs » FT36612

$18.00

FT36612
[FT36612]

FT36612
hg38 Position: ChrY:8781283..8781283
Ancestral: C
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J2
Comments: Below L26 > L25 > L192 > FGC30640
Forward Primer: FT36612_F CTCAGCAGTCCAGCCCTTAC
Reverse Primer: FT36612_R CGATGTCAGGCATCAGTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies