Top » Catalog » SNPs » A228

$18.00

A228
[A228]

A228
hg38 Position: ChrY:15703461..15703461
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c~
Comments: Downstream R1b-Z251
Forward Primer: A228v2_F GCTGGCTCAGAGGATAGGTG
Reverse Primer: A228v2_R ATGAAAGATTTCATAGTCAAAATGTATG
Reviews

Customers who bought this product also purchased
FGC18229
FGC18229
A959
A959
DNA Sample Kit
DNA Sample Kit
CTS4157
CTS4157
S11556
S11556
L555
L555
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies