Top » Catalog » SNPs » A228

$18.00

A228
[A228]

A228
hg38 Position: ChrY:15703461..15703461
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c~
Comments: Downstream R1b-Z251
Forward Primer: A228v2_F GCTGGCTCAGAGGATAGGTG
Reverse Primer: A228v2_R ATGAAAGATTTCATAGTCAAAATGTATG
Reviews

Customers who bought this product also purchased
FGC18229
FGC18229
CTS4157
CTS4157
S11556
S11556
L555
L555
R1b-Z251 Panel (including 251-11EE subclades)
R1b-Z251 Panel (including 251-11EE subclades)
Z16944
Z16944
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies