Top » Catalog » SNPs » A27237

$18.00

A27237
[A27237]

A27237
hg38 Position: ChrY:12584911..12584911
Ancestral: A
Derived: C
Reference: Xin Lu (2020)
ISOGG Haplogroup: O
Comments: Below CTS201 > SK1702
Forward Primer: A27237_F AATAACATCTAGTATTTGATAGCAGAACCA
Reverse Primer: A27237_R AGTTTTTGTGGGTGTATAGTAGAGGTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies