Top » Catalog » SNPs » BY154453

$19.00

BY154453
[BY154453]

BY154453
hg38 Position: ChrY:15583282..15583282
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY154453_F AAGCTTTGTAATCTTCCTGATAGAACA
Reverse Primer: BY154453_R TTCTGATAAGTCATGCCAGTGAAC
Reviews

Customers who bought this product also purchased
A25508
A25508
FGC1707
FGC1707
Y162045
Y162045
FGC4415
FGC4415
ZS8277
ZS8277
FGC1696
FGC1696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies