Top » Catalog » SNPs » BY154453

$19.00

BY154453
[BY154453]

BY154453
hg38 Position: ChrY:15583282..15583282
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY154453_F AAGCTTTGTAATCTTCCTGATAGAACA
Reverse Primer: BY154453_R TTCTGATAAGTCATGCCAGTGAAC
Reviews

Customers who bought this product also purchased
FGC1721
FGC1721
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Y94440
Y94440
YSC0000234
YSC0000234
ZS8273
ZS8273
ZS8508
ZS8508
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies