Top » Catalog » SNPs » BY23874

$18.00

BY23874
[BY23874]

BY23874
hg38 Position: ChrY:12899542..12899542
Ancestral: G
Derived: C
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below L627. With FGC3911
Forward Primer: BY23874_F CGAATCACTTGAGCCCAGAG
Reverse Primer: BY23874_R GGTCTATGATTCATTTTGAGTTAATTCTG
Reviews

Customers who bought this product also purchased
FGC3920
FGC3920
FGC3926
FGC3926
FGC3912
FGC3912
FGC3918
FGC3918
FGC3938
FGC3938
FGC3911
FGC3911
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies