Top » Catalog » SNPs » BY23874

$18.00

BY23874
[BY23874]

BY23874
hg38 Position: ChrY:12899542..12899542
Ancestral: G
Derived: C
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below L627. With FGC3911
Forward Primer: BY23874_F CGAATCACTTGAGCCCAGAG
Reverse Primer: BY23874_R GGTCTATGATTCATTTTGAGTTAATTCTG
Reviews

Customers who bought this product also purchased
L627
L627
FGC3919
FGC3919
FGC3934
FGC3934
L626
L626
FGC3914
FGC3914
FGC3931
FGC3931
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies