Top » Catalog » SNPs » FGC3926

$18.00

FGC3926
[FGC3926]

FGC3926
hg38 Position: ChrY:14357864..14357864
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: Below DF21 > DF5 > FGC3911 > FGC3906
Forward Primer: FGC3926_F GTTATGGAGACCAGGGAAACG
Reverse Primer: FGC3926_R AAAAGGTCAAAAGACTGTCTTATTCTTAG
Reviews

Customers who bought this product also purchased
L626
L626
FGC3914
FGC3914
BY23874
BY23874
R1b-FGC3911 Comprehensive Test
R1b-FGC3911 Comprehensive Test
FGC3913
FGC3913
FGC3920
FGC3920
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies