Top » Catalog » SNPs » FGC3926

$18.00

FGC3926
[FGC3926]

FGC3926
hg38 Position: ChrY:14357864..14357864
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: Below DF21 > DF5 > FGC3911 > FGC3906
Forward Primer: FGC3926_F GTTATGGAGACCAGGGAAACG
Reverse Primer: FGC3926_R AAAAGGTCAAAAGACTGTCTTATTCTTAG
Reviews

Customers who bought this product also purchased
L627
L627
FGC3919
FGC3919
FGC3931
FGC3931
L626
L626
FGC3914
FGC3914
BY23874
BY23874
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies