Top » Catalog » SNPs » FGC3938

$18.00

FGC3938
[FGC3938]

FGC3938
hg38 Position: ChrY:21181034..21181034
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: Below L627. With FGC3911
Forward Primer: FGC3938_F AAAGTGATCAGGTACCTAAATGGC
Reverse Primer: FGC3938_R AATTTGCTTTTAATTGTTCCTAAACTG
Reviews

Customers who bought this product also purchased
BY23874
BY23874
R1b-FGC3911 Comprehensive Test
R1b-FGC3911 Comprehensive Test
FGC3913
FGC3913
FGC3920
FGC3920
FGC3926
FGC3926
FGC3912
FGC3912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies