Top » Catalog » SNPs » A241

$18.00

A241
[A241]

A241
hg38 Position: ChrY:6886664..6886664
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1j~
Comments: Downstream R1b-Z251
Forward Primer: A241_F TGTGGTACACATCTGTATTTCTAGCTC
Reverse Primer: A241_R GCGATGAGTCAGTTTGATGC
Reviews

Customers who bought this product also purchased
A964
A964
A968
A968
DF41
DF41
Z253
Z253
Z255
Z255
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies