Top » Catalog » SNPs » A242

$18.00

A242
[A242]

A242
hg38 Position: ChrY:7658736..7658736
Ancestral: T
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A242_F TGGGGTAAGGGTCAAAGGTC
Reverse Primer: A242_R CACAGCACCCTACACCTCAG
Reviews

Customers who bought this product also purchased
FGC13909
FGC13909
A238
A238
A246
A246
A252
A252
A458
A458
A232
A232
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies