Top » Catalog » SNPs » A242

$18.00

A242
[A242]

A242
hg38 Position: ChrY:7658736..7658736
Ancestral: T
Derived: G
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream R1b-Z251
Forward Primer: A242_F TGGGGTAAGGGTCAAAGGTC
Reverse Primer: A242_R CACAGCACCCTACACCTCAG
Reviews

Customers who bought this product also purchased
A254
A254
A228
A228
A241
A241
FGC13933
FGC13933
A247
A247
A253
A253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies