Top » Catalog » SNPs » FGC3909

$18.00

FGC3909
[FGC3909]

FGC3909
hg38 Position: ChrY:7191434..7191434
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC3909_F GCCTTGCCCATGACTACATG
Reverse Primer: FGC3909_R GACCTCTTCAAGGTGAGGTCAG
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
FGC3923
FGC3923
FGC3939
FGC3939
FGC3915
FGC3915
FGC3937
FGC3937
FGC3932
FGC3932
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies