Top » Catalog » SNPs » FGC3927

$18.00

FGC3927
[FGC3927]

FGC3927
hg38 Position: ChrY:14497164..14497164
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC3927_F GTATATCCTATGTGCTAGAGACTGCG
Reverse Primer: FGC3927_R GGTTTCACCATGTTGCTGC
Reviews

Customers who bought this product also purchased
FGC3944
FGC3944
FGC3928
FGC3928
FGC3921
FGC3921
FGC3910
FGC3910
R1b-L626 Segregation Panel
R1b-L626 Segregation Panel
FGC3924
FGC3924
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies